Exome sequencing revealed a novel homozygous variant in TRMT61 A in a multiplex family with atypical Cornelia de Lange Syndrome from Rwanda

Abstract

Background

In 30% of patients who exhibit the clinical profile of Cornelia de Lange Syndrome (CdLS), the genetic cause remains undetermined. This proportion tends to be higher in low-resource settings including Africa. We performed a molecular characterization of CdLS in a multiplex Rwandan family.

Methods

After a clinical evaluation of two affected siblings, DNA isolated from peripheral whole blood of the affected patients and their parents underwent Exome Sequencing (ES). Sanger sequencing validated the variant segregating with CdLS. In silico predictive tools, protein modelling, and cell-based experiments using HEK293T cells were used to investigate the pathogenicity of the variant found.

Results

We identified a family with two parents and their two offspring (male and female), who were referred for hearing impairment. The 17-year-old female presented bilateral profound hearing impairment with moderate hypertelorism, progressive visual impairment, and secondary amenorrhea. The 14-year-old male displayed intellectual disability and a bilateral profound hearing impairment with no noticeable facial dysmorphism. Following exome sequencing (ES) of DNA samples obtained from the four family members, we found that the siblings harbored a novel likely pathogenic homozygous missense variant in the TRMT61 A gene [NM_152307.3:c.665C > T p.(Ala222Val)] inherited from both heterozygous parents. In silico analysis suggested that the variant substitutes a highly conserved amino acid, and 2-D structure modelling revealed a significant decrease in the stability of the protein. Cell-based experiment in HEK293T showed that the variant significantly affected the TRMT61 A protein localization which is thought to impact the mitochondrial and cytosolic functions.

Conclusion

We reported a novel biallelic variant in TRMT61 A, [NM_152307.3:c.665C > T p.(Ala222Val)], which is associated with autosomal recessive atypical CdLS in a multiplex Rwandan family, the first report from Africa, and the second globally. The study emphasizes the need to expand the availability of ES for molecular characterization of rare diseases for the understudied genetically diverse population of Africa.

Introduction

Cornelia de Lange Syndrome (CdLS) is a rare genetic disease affecting < 1:2,000 and < 1:200,000 in the European Union and the US respectively [8]. Typical clinical signs include developmental and cognitive delay, growth restrictions, typical craniofacial dysmorphism including hirsutism [6]. Other features include limb and cardiac defects, hearing and vision impairment, and gastrointestinal and genitourinary disorders [6, 34]. Due to the extreme heterogeneity and phenotype spectrum, from mild to severe, the condition is classified as classic or non-classic, depending on the underlying genetic cause and the molecular algorithm used in the diagnosis [12].

The CdLS spectrum includes patients who exhibit the classic CdLS phenotype, in which the involved pathogenic gene variant plays a role in the cohesin functioning is either known or unknown (in which case the diagnosis is made based on clinical presentation if the implicated variant is unknown), as well as patients with a non-classic CdLS phenotype caused by a variant in a gene involved in cohesin functioning. Of note, both mildly and severely affected patients may exhibit classic and non-classic phenotypes of CdLS [12]. Therefore, CdLS is also genetically heterogeneous with up to seven associated genes in 70% of cases [12], namely, NIPBL, SMC1 A, SMC3, RAD21, BRD4, HDAC8, and ANKRD11 [3, 6, 27, 11, 34]. In addition, the TRMT61 A gene has been reported to cause recessive CdLS in two siblings, but this association has not yet been well established by reports from and non-related additional affected families, or by functional investigations. However, CdLS is understudied on the African continent, with cases only reported from South Africa [33].

In this study, we performed a molecular characterization of an atypical CdLS in a multiplex Rwandan family using Exome Sequencing (ES), in silico prediction, protein modelling, and cell-based experiments HEK293 T. We described a novel homozygous likely pathogenic variant in TRMT61 A, [NM_152307.3:c.665 C > T p.(Ala222 Val)], in two affected siblings, the first report from Africa, and the second globally.

Subjects, material, and methods

Participants and clinical assessments

Participants were enrolled at schools for the Deaf during community engagement activities across different regions of Rwanda, following a previously reported procedure [39]. A general practitioner, a medical geneticist, and an ear, nose, and throat (ENT) specialist reviewed the detailed personal history and medical records of affected individuals. Clinical examinations were performed, and pure tone audiometry (PTA) was conducted. The degree of HI was classified according to the American Speech-Language-Hearing Association (ASHA) [2].

Molecular investigations

Exome sequencing

Following the exclusion of GJB2 and GJB6, DNA from both sibling and their parent i.e., individuals I.1, I.2, II.1, and II.2 (Fig. 1A) underwent ES. Exomic libraries were prepared using the SureSelect Human All Exon V6 kit (Agilent Technologies, Santa Clara, CA, USA). Paired-end sequencing with 150 bp pair-end reads was conducted on a NovaSeq 6000 system (Illumina Inc., San Diego, CA, USA). Reads were aligned to the human reference genome hg38 using Burrows–Wheeler Aligner-MEM [14]. We performed joint variant calling via the Genome Analysis Toolkit v3 (GATK v3) [19]. Plink v1.9 was used to confirm the sex of each participant while familial relationships of all members were verified using Identity-by-Descent sharing (plinkv1.9) and the Kinship-based INference for Gwas (KING) algorithm [7, 17].

Fig. 1

Pedigree, audiogram, chromatogram, amino acid conservation and protein modeling data of multiplex family RW.KG.SFS_.09. A Two-generation pedigree suggestive of an incomplete penetrance autosomal dominant mode of inheritance of the Cornelia de Lange syndrome. The black arrow indicates the proband. B Air conduction of pure tone audiometry of the affected brother and sister showing bilateral profound HI. C Photo of the affected female showing mild hypertelorism. D Chromatograms of Sanger sequencing of the missense TRMT61 A variant in the TRMT61 A gene [NM_152307.3:c.665 C > T p.(Ala222 Val)] and the reference allele (indicate the segregation on the pedigree). The position of the nucleotide change is highlighted in blue. E Evolutionary conservation of the TRMT61 A: p.(Ala222 Val) variant position (indicated by the red asterisk). F (1) Wild type, (2) Mutant, showing major structural changes (Black boxes). C/T, heterozygous mutant allele; T/T, homozygous mutant allele; Hom Mut, homozygous mutant for the variant allele; Het Ref, heterozygous reference allele

Annotation and filtering strategy

We performed variant filtering and annotation via ANNOVAR as previously described (29, 38). Variants were prioritized according to the assumed inheritance pattern (autosomal recessive or dominant), and variants with minor allele frequency (MAF) in all populations of the genome aggregation database (gnomAD, version v4.1.0). Only rare variants with a MAF below 0.005 for recessive and below 0.0005 for dominant inheritance, were retained. Additionally, known pathogenic or likely pathogenic HI variants listed in ClinVar were also investigated, regardless of their frequencies. After annotation, we employed in silico bioinformatics prediction scores from dbNSFP to assess the damaging effects of missense variants. In addition, we performed in silico predictions of synonymous and splicing variants using spliceAI and Human Splice Finder (HSF) tools to investigate the functional impact of potential intronic and splice variants.

Additional tools utilized to assess the pathogenicity of the variant included PolyPhen-2, SIFT, MutationTaster, DANN, CADD, TOPMed Freeze 9b, all of us and GERP +  + scores [1, 9, 21, 25, 26, 31]. Furthermore, variants were classified according to the American College of Medical Genetics (ACMG) [18].

Sanger sequencing

The variants identified underwent validation via direct sequencing and their segregation amongst available family members (Fig. 1). Furthermore, the candidate variant was screened in 100 healthy control individuals from Rwanda. Sequence-specific primer pairs targeting the variant region in exon 4 of the TRMT61 A gene were designed and evaluated using NCBI Primer BLAST. Selected primers were evaluated with IDT online primer optimization software. PCR followed by bi-directional Sanger sequencing were conducted using primer pair (Table S2) at the Division of Human Genetics, University of Cape Town, South Africa. FinchTV v1.4.0 [37] software was employed for the manual inspection of ABI file chromatograms, which were then aligned to the TRMT61 A reference sequence.

Evolutionary conservation

We aligned the sequence spanning the candidate variant found here with non-human species similar proteins to evaluate the conservation of the respective amino acid (aa). NCBI BLAST search against the non-redundant protein database was performed and the first 50 hits of different species were manually retrieved as FASTA files. Multiple sequence alignment (MSA) was performed using Clustal Omega [16] and the resulted alignments were viewed using Jalview version 2.11.4.1.

Secondary (2D) and three-dimensional (3D) protein modeling

The protein sequence (NP_689520.2) of TRMT61 A was retrieved from NCBI. The secondary structure was predicted on PSIPRED [4], and the 3D structure was modeled on SWISS-MODEL using AlphaFold structure (Q96 FX7) as a template [32]. The newly predicted structure was refined on the GalaxyWeb server [13]. Structure visualization and analysis were performed with Pymol software [30]. In addition, the I-mutant2.0 platform was used to investigate the stability of the mutant protein [5].

Expression pattern in human inner ear organoids and mouse

To investigate the expression pattern of TRMT61 A in vitro, we accessed the Human Inner Ear Organoids (scRNAseq and snRNAseq) and P1 mouse (scRNAseq) data from gene expression analysis resources (gEAR) [22]. The expression pattern in specific cells was analyzed.

In vitro functional HEK293 T assay of the candidate TRMT61 A variant

Site-directed mutagenesis

Mammalian expression plasmids expressing open read frame of the human TRMT61 A with C-terminal tGFP-tag (#RG204071) was purchased from Origene and used as template for site directed mutagenesis (SDM) using our primers (Forward: CTGGCAGTGCGCGGCTTCTC and Reverse: CGCCTGGCATGTGCGTTGC) acquired from Integrated DNA Technologies (IDT, Coralville, IA, USA). SDM was performed in laboratory at the Department of Genetic Medicine, Johns Hopkins University, Baltimore, USA, using a protocol available upon request. Long read sequencing (LRS) of the plasmids was performed at Plasmidsaurus (Eugene, OR, USA) to confirm the variant of interest and assess any unwanted changes.

Cell culture, transfections, and visualization using confocal microscopy

Human embryonic kidney (HEK293 T) cells were cultured in complete Dulbecco’s Modified Eagle Medium (DMEM) (Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 10% fetal bovine serum (Thermo Fisher Scientific, Waltham, MA, USA) and 1% Glutamine. Cells were cultured in a humidified incubator at 37 °C with 5% CO2. The HEK293 T cells were plated in 4-chamber dishes (density 5 × 10⁴ cells per mL), 18 h before transfection. Cells were transiently transfected using TurboFect transfection reagent according to the manufacturer’s instructions (Waltham, MA, USA), with 250 ng of plasmid (Empty, tGFP-only, tGFP-tagged wildtype and mutant of TRMT61 A). Cells were stained with Hoechst 33,342 (1:1000 dilution) dye for co-visualization of nuclear material. Live viewing (10 X and 40X) was performed at 48 h after transfection using Olympus FV3000RS Confocal Microscope. Images were visualized and processed using the FV31S-W viewer software.

Western blots

HEK293 T cells were incubated (density 6 × 10⁵ cells per mL) in 6-well plates, 18 h before transfection. Cells were transfected using TurboFect transfection reagent (Waltham, MA, USA) according to the manufacturer’s instructions, with 2000 ng of the WT or MT-TRMT61 A plasmid fused with the tGFP tag and non-transfected cells with no plasmid DNA. Total protein lysates were collected at 48 h for both genes using radioimmunoprecipitation assay (RIPA) buffer, with protease inhibitor cocktail (#P8340). Proteins were briefly sonicated and concentrations were checked using Qubit5 fluorometer. Then, 30ug total protein was denatured (85ºC, over 2 min) and loaded onto NovexTM WedgeWellTM 4–20% Tris–Glycine Gel. The gel electrophoresis was run at 100 V over 90 min. Proteins were transferred onto iBlot® 2 regular Stacks, nitrocellulose (NC), regular size (Invitrogen, Thermo Fischer, Scientific, Waltham, Massachusetts, USA). Membrane was stained with Revert TM 700 Total Protein Stain (LI-COR Biosciences, Lincoln, Nebraska). Then, the membrane was incubated with primary Mouse monoclonal turboGFP antibody (#TA150041; dilution 1:1000) and secondary antibody anti-Mouse (product #A11371; dilution 1:10,000; Thermo Fisher). Target signals were normalized to total protein signals to allow for a relative comparison of the wild type and mutant.

Results

Patients’ demographics and phenotypic descriptions

We identified a family of four (Fig. 1A), with two siblings referred for evaluation, as part of a study on HI in Rwanda. Upon clinical examination, the 17-year-old female presented bilateral profound HI (Fig. 1B), moderate hypertelorism, arched and thick eyebrows (Fig. 1C), progressive visual impairment, and secondary amenorrhea. Conversely, the 14-year-old affected male had intellectual disabilities, bilateral profound HI clinically confirmed by an audiogram, and low-set ears. There were no reported perinatal hazardous environmental exposures that could have contributed to their HI and other phenotypes. The phenotypic description that does not feature the typical facial phenotypes and the molecular analysis suggest a non-classical familial form of CdLS.

Exome sequencing analysis

The average target region coverage was about 100X, with 96.30% of targeted regions covered at 10X or more. After applying various filtering criteria (described in the method section), the following variants were considered;

There was no variant detected in GJB2 and GJB6 genes, however, a homozygous missense variant, NM_152307.3:c.665 C > T p.(Ala222 Val), was called in the TRMT61 A gene by ES. The variant was validated by Sanger sequencing, where both parents were confirmed to be carriers of the variant (Fig. 1A and D). At the same time, the affected male and female harbored a homozygous form of the variant. The variant was not detected in any of the healthy controls (n = 100). The in-silico tools predicted the variant to be damaging (Supplementary Table 4). The variant was classified as likely pathogenic following the ACMG guidelines (PP1, PP3, PS3, PM2).

Evolutionary conservation of amino acid

The position of the variant p.(Ala222 Val) was found to be 100% conserved across the top 50 hits resulted from the NCBI BLAST search (Fig. 1E). The region across which the amino acid is located is remarkably conserved and the variant could have led to the change in the structure and function of the protein.

Secondary and three-dimensional (3D) protein modeling

Secondary structure analysis revealed that the mutant protein loses a helical structure located at ¹⁶⁴VCR¹⁶⁶ and gains a new beta-strand structure at ¹⁹⁷VR¹⁹⁸ (Fig. 1F). In addition, I-mutant 2 prediction showed that the variant decreases the stability of the protein compared to the wild type. However, the 3D structure did not reveal significant changes in the mutant compared to the wild type (Supplementary Fig. 5).

In vitro functional HEK293 T assay

Live viewing confirmed the successful transfection and expression of tGFP, WT and mutant (Fig. 2A-C). However, the fluorescence signal was lower in mutant protein compared to WT. In addition, the WT tGFP fused protein seems to localise in the nucleus and cytoplasm as expected (Fig. 2D). On the other hand, the mutant protein appears to accumulate and localise mainly in the nucleus (Fig. 2E). Furthermore, western blot analysis showed that the specific bands were at ~ 60 kDa for WT and mutant, however, the normalized target signal was lower in mutant protein (Fig. 2F, G, Supplementary Figure S2 and Supplementary Table 3), consistent with the finding of the confocal microscopy analysis.

Fig. 2

Functional analysis using HEK293 T cells. A-C Confocal microscopy images at 10X showing the co-localization of the nuclear material (blue) and tGFP fused TRMT61 A protein (green) of tGFP, wild type and mutant, respectively. D Wild type TRMT61 A at 40X showing a nuclear and cytoplasmic localisation (white arrows), E Mutant TRMT61 A at 40X showing a predominant nuclear accumulation (white arrows), F-G Western blot analysis showing the decreased level of the normalised target signal in the mutant protein compared to the wild type. L: stands for the ladder, WT: wild type and MT: mutant

Expression pattern in Human inner ear and mouse

Expression analysis showed that TRMT61 A is expressed in both human inner ear organoids and mouse RNAseq data including the hair and supporting cells (Fig. 3A-C).

Fig. 3

Expression profile of TRMT61 A. A Human inner ear organoids. B-C P1 mouse

Discussion

Molecular characterization of rare diseases such as CdLS have been rarely reported in Sub-Saharan Africa. Using ES in a multiplex family with two cases, we describe an autosomal recessive case of atypical form of CdLS due to a novel homozygous missense variant, c.665 C > T p.(Ala222 Val), in the TRMT61 A gene. We reported clinical evidence of two affected sibling, in silico pathogenic scores using PolyPhen-2 and Mutation Taster, and functional assays in HEK293 T cells which found that the NM_152307.3:c.665 C > T p.(Ala222 Val) variant significantly alter TRMT61 A protein localization, which is thought to impair both mitochondrial and cytosolic functions. Taken together, these findings suggest that the variant is likely pathogenic and may have a causal relationship with the clinical phenotypes observed in the two siblings.

The affected Rwandan brother and sister can still be classified as atypical cases of CdLS, although they lack many of the classical characteristics typically associated with the condition. Specifically, they do not exhibit the hallmark features such as significant growth and cognitive delays, hirsutism, distinct facial dysmorphism, or limb malformations—particularly of the upper limbs. However, both siblings presented with speech impairment and bilateral profound HI, symptoms commonly observed in CdLS. Additionally, the affected brother presented with intellectual disability and low-set ears while the affected sister displayed arched and thick eyebrows, hypertelorism, progressive vision loss, and secondary amenorrhea—features that have also been documented in individuals with CdLS. The carrier parents were seemingly healthy and did not show any phenotypes.

In contrast, two Palestinian sisters described by Sharif in 2020 exhibited a more typical CdLS phenotype. Their clinical presentation included craniofacial abnormalities such as microcephaly, synophrys, anteverted nares, and micrognathia, as well as pronounced speech and hearing impairments. Furthermore, they experienced growth and cognitive retardation, hirsutism, upper limb anomalies, and gastrointestinal complications. These sisters were found to carry compound heterozygous variants—an in-frame deletion and a missense mutation—in the TRMT61 A gene, consistent with an autosomal recessive inheritance pattern. Their parents were each heterozygous carriers of the respective variants: [c.478_483 delCGCACC:p.(R160_T161 del)] and [c.323G > T:p.(C108 F)]. Therefore, the Rwandan siblings represent only the second reported instance worldwide of CdLS associated with likely pathogenic variants in TRMT61 A, broadening the phenotypic spectrum of TRMT61 A-related CdLS.

PolyPhen-2 and mutation taster computational predictive tools predicted that the variant, c.665 C > T p.(Ala222 Val), is damaging (Supplementary Table S4). The decreased expression and mis-localization of mutant TRMT61 A in cell-based experiments suggest that the predominantly nuclear localisation caused by the variant could impact the mitochondrial and cytosolic functions of TRMT61 A [15, 28]. The high conservation of the amino acid across several species (Fig. 1E) could explain the fault in the protein’s structure and function when mutated, hence the CdLS phenotype.

TRMT61 A gene exists in a heterotetramer complex of 2 TRMT61 A subunits and 2 TRMT6 subunits. The two genes work together to regulate gene expression by ensuring the necessary post-transcription modification of tRNA and mRNA [10, 35]. TRMT61 A encodes for the tRNA-methyltransferase enzyme, which converts N1 adenine at position 58 into N₁-methyladenine 58 (m1 A58) by catalyzing the methylation reaction that transfers a methyl group from the methyl donor (S-adenosyl-methionine) to N1 of adenine 58 in the initiator methionyl-tRNA [23]. Studies have linked defects in tRNA modification processes to various human diseases such as cancer, type 2 diabetes, neurological disorders, and mitochondrial-linked disorders, underscoring the importance of genes like TRMT61 A in cellular physiology [36]. Studies are yet to clarify the specific relationship between TRMT61 A and the other genes known to be the main contributors to CdLS, such as NIPBL and SMC1 A; however, TRMT61 A is one of the accessory genes misregulated when these genes are mutated in CdLS patients [11]. Coupled with this, TRMT61 A and NIPBL genes both play a role in gene expression and genome stability, which plausibly could partly explain its association with CdLS [20, 24].

Conclusion

We reported a novel biallelic variant in the TRMT61 A gene [NM_152307.3:c.665 C > T p.(Ala222 Val)] which is associated with atypical CdLS in two sibling from a multiplex Rwandan family, the first report from Africa, and the second globally. The study emphasized the need to expand availability of whole exome sequencing for molecular characterization of rare diseases for understudied genetically diverse populations of Africa.