Identifying novel heterozygous PI4KA variants in fetal abnormalities

Abstract

Background

The clinical manifestations of PI4KA-related disorders are characterized by considerable variability, predominantly featuring neurological impairments, gastrointestinal symptoms, and a combined immunodeficiency. The aim of this study was to delineate the novel spectrum of PI4KA variants detected prenatally and to assess their influence on fetal development.

Methods

A thorough fetal ultrasound screening was conducted, supplemented by both antenatal and post-abortion magnetic resonance imaging (MRI) studies. Novel PI4KA variants were detected through clinical Whole exon sequencing (WES) and validated by Sanger sequencing. The functional consequences of these variants were evaluated using bioinformatics tools. The effects of the identified variants on splicing were analyzed through minigene splicing assays. Subsequently, both wild-type and mutant PI4KA protein fragments were purified, and their enzymatic activities were quantitatively assessed.

Results

Ultrasound imaging, MRI scans revealed a dilated small intestine with an obstruction. Compound heterozygous variants (NM_058004.3: c.2802_2863-40del and c.2819 C > T, p.Ala940Val) were identified in the PI4KA of the affected fetus through clinical trio-WES. Both variants were predicted deleterious. The PI4KA variant c.2802_2863-40del resulted in the production of three distinct mRNA isoforms. The PI4KA variant c.2819 C > T (p.Ala940Val) significantly reduced the enzyme activity.

Conclusions

This study extended the mutational spectrum of PI4KA and may provide guidance for genetic counseling. Functional studies confirmed that the identified variant induces alterations in RNA splicing and impairs enzyme activity.

Introduction

The enzyme phosphatidylinositol 4-kinase III alpha (PI4KA) is a widely distributed protein that generates the 4-phosphate lipid component within the plasma membrane [1]. This critical phosphoinositide plays essential roles in various signaling pathways, the regulation of vesicle transport, and in defining the identity of cellular compartments. As a key lipid kinase, PI4KA assumes a central role in a broad array of biological processes [2]. It is predominantly involved in the catalysis of phosphatidylinositol 4-phosphate (PI4P), a lipid that is essential for a multitude of cellular activities [3]. PI4KA is vital for the architecture of myelin, where it facilitates the production of PI4P to provide essential lipids and modulate actin cytoskeleton dynamics, thereby ensuring structural integrity and functional efficacy [4]. In plants, particularly in Arabidopsis thaliana, PI4KA influences key developmental processes, including pollen, embryonic, and post-embryonic stages [3]. Additionally, PI4KA serves as an essential host factor for the replication of hepatitis C virus [5]. In the nervous system, PI4KA regulates neuronal microtubule depolymerase kinesin, KIF2A, and suppresses elongation of axon branches [6]. PI4KA also participates in the processes of cancers including leukemia and prostate cancer [7].

Mutations in the PI4KA are associated with a rare genetic disorder that presents with a broad phenotype spectrum, affecting multiple systems and organs such as the nervous system, immune system, and digestive system. However, the prenatal manifestations of PI4KA-related variants in fetal cases have been scarcely documented. Here, we present a fetal case with compound heterozygous PI4KA variants, investigated through prenatal ultrasound, maternal MRI, whole exon sequencing and post-abortion MRI. Additionally, we conducted functional studies on the two identified variants.

Materials and methods

Ultrasound examinations

A comprehensive ultrasound assessment was performed on the fetus including 2D, 3D, Doppler ultrasound and echocardiography. The fetus was scanned using a GE Volusion E10 machine with a 1–5 MHz sector transducer. The final diagnosis was obtained by two senior physicians.

Genetic testing

The clinical Whole exon sequencing-Trio service was conducted in the family. The method was described previously [8]. DNA was extracted from the umbilical blood in the fetus and the peripheral blood in the parents. Firstly the DNA was broken and the DNA library was prepared. Then, the DNA in exons and adjacent shear regions of target genes was captured and enriched by Roche KAPA HyperExome chip. Finally, the MGISEQ-2000 sequencing platform was used for variant detection. The quality control indexes for the sequencing data included an average sequencing depth of at least 180X across the target region, with greater than 95% of the loci within the target region achieving an average depth of over 20X.

Sequenced fragments were mapped to the UCSC hg19 human reference genome by BWA, followed by the removal of duplicate reads. Base quality scores were refined using GATK for SNV, INDEL detection and genotyping. ExomeDepth was employed to conduct exon-level copy number variant analysis.

The classification of variant pathogenicity adhered to the American College of Medical Genetics and Genomics (ACMG) and American Molecular Pathology Society (AMP) Sequence Variation Interpretation Guidelines.

Variants validation

The deletion variant was validated using Sanger sequencing in both the parents and the fetus. The primers are as following: PI4KA_EX24_1F-TGGGAAATCCAGACGAAGTC, PI4KA_EX24_1R-TGTCTGCCACCCTCCTTATC; PI4KA_EX24_1F2-TTTGACACATCAGCCTGGTT, PI4KA_EX24_1R2-CATACACACAAAACATTAGCAGGA. The missense mutation was validated utilizing Mass spectrometry assay.

Bioinformatics analysis

Multiple bioinformational tools were used to predict the two variants. VarCards database (http://www.genemed.tech/varcards/) was used to predict the functional effect of the variant c.2819 C > T (p.Ala940Val): and SpliceAI Lookup (https://spliceailookup.broadinstitute.org/) was used to predict the variant c.2802_2863-40del.

Minigene splicing assay

Two target gene insertion fragments were obtained by amplifying normal human genomic DNA using a seamless cloning kit. Subsequently, wild-type and mutant PI4KA minigene plasmids were constructed respectively. The two paired primers used for wild-type were as following: PI4KA-AF: AAGCTTGGTACCGAGCTCGGATCCTAATGTTCTGCTACTTTGAGGATAAAGC, PI4KA-AR: TTGGTTTGAGGACGACAAGTTGCATCTGGAAGCAAG; PI4KA-BF: ACTTGTCGTCCTCAAACCAAGGGATCAAGGTTAGCTTC, PI4KA-BR: TTAAACGGGCCCTCTAGACTCGAGAGCGCTCAGTGACAGTGACAGGGTCTGC. The mutant fragment was engineered based on the wild-type plasmid template. The paired primers used for generating the mutation were as follows: PI4KA-MT-F TCAGGGATGATGCATCTGGGGCACTGCGGTACCT, PI4KA-MT-R CAGATGCATCATCCCTGAAACGAGAAGGTTTCCA. HEK293T cells were harvested 48 h post-transfection, and total RNA was isolated using the TRizol extraction method. Subsequently, cDNA was synthesized, and subjected to PCR amplification. The size of the PCR products was analyzed, and the sequencing results were interpreted. The primers used for reverse transcription PCR (RT-PCR) were as follows: MiniRT-F: GGCTAACTAGAGAACCCACTGCTTA; PI4KA-RT-R: GATGTCCAGCATGGTCTTCAGCAC.

Enzymatic activity measurement

Investigating the function of the full-length human PI4KA protein is complex due to its large molecular size. Therefore, a wild-type or mutant PI4KA (c.2794–6309) construct with a C-terminal Flag tag was engineered using the ptt5 plasmid. The PI4KA protein encompasses several domains, including the leucine zipper (LZ; amino acids 993–1021), helix–loop–helix (HLH; amino acids 1351-1364aa), lipid kinase unique domain (LKU; amino acids 1621-1689aa), Pleckstrin homology domain (PH; amino acids 1718-1851aa), and catalytic domain (Cat; amino acids 1848-2103aa). Wild-type or mutant PI4KA constructs was transfected into HEK293 cells for protein expression purification. The cells were seeded in 300 ml of medium within a 1 L shaker at a density of 0.5 × 10E⁶ cells/ml. After adding filtered DNA and incubating for 6 days, the supernatant was harvested. The supernatant was then mixed with Anti-Flag Affinity Beads (M7002, Mabnus, Wuhan) to isolate the target protein. SDS-PAGE analysis was used to verify the expression of the wild-type or mutant PI4KA proteins. Following protein enrichment with Anti-Flag Affinity Beads, the enzyme activity was accessed using the ADP-Glo™ Kinase Assay Kit (V6930, Promega).

Results

Clinical manifestation of the abnormal fetus

The pregnant woman was first referred to our hospital at 34 weeks of gestation (GW) for an ultrasound examination. The scan revealed a single live fetus. Notably, the fetal abdominal circumference was increased by 2.2 standard deviations (Fig. 1A). The flow velocity in the fetal middle cerebral artery was elevated, with a Mom value of 1.49 indicating mild to moderate fetal anemia. The amniotic fluid contained echogenic floating particles. Ascites was detected within the fetal abdomen, and polyhydramnios was observed (Fig. 1B). The ultrasound also identified a segment of the fetal intestine that was dilated, measuring approximately 12.3 cm in length with a maximum internal diameter of 2.5 cm (Fig. 1C and D). The intestine contained dense echogenic foci, and the adjacent intestinal segment appeared spiral in nature, with an inner diameter of about 1.1 cm. No other abnormalities were detected in the fetal systems.

Fig. 1

Ultrasound and MRI findings of the fetus. (A) Ultrasound image showing an increased abdominal circumference of the fetus, with a measurement of 2.2 standard deviations (SD) above the mean. (B) Ultrasound image depicting ascites within the fetal abdomen, indicated by anechoic fluid spaces. (C-D) The part of the fetal intestine was dilated with a length about 12.3 cm and maximum inner diameter of 2.5 cm. (E) Prenatal MRI scan of the fetal brain showing no significant abnormalities, with normal brain structure and morphology. (F-G) Post-abortion MRI scans of the aborted fetus revealing dilatation of the small bowel, confirming the prenatal ultrasound findings. The images demonstrate the extent and location of the bowel dilation

Fetal brain MRI revealed no substantial abnormalities (Fig. 1E). Abdomen MRI indicated dilation of the jejunum and ileum, and the colons were tiny. Colonic obstruction was suspected. Additionally, abdominal ascites and mild fetal hydrops were detected. Following a comprehensive interdisciplinary consultation, the parents decided to terminate the pregnancy. Post-termination MRI of the fetus confirmed dilatation of the small bowel, suggestive of obstruction, and the rectum was visualized (Fig. 1F and G).

Compound heterozygous variants of PI4KAcasusing fetal abnormalities

Throughout the diagnostic evaluation, the patient did not undergo karyotype analysis, comparative genomic hybridization (CGH) array, or any additional genetic testing beyond trio-WES. Trio-WES identified compound heterozygous variants (NM_058004.3: c.2802_2863-40del and c.2819 C > T) in the Phosphatidylinositol 4-Kinase Alpha (PI4KA) of the affected fetus (Fig. 2A). No other variants of pathogenic or likely pathogenic significance that associated with the clinical findings were discovered. The c.2819 C > T variant led to a substitution at amino acid position 940, with alanine (Ala) being replaced by valine (Val). According to the American College of Medical Genetics and Genomics (ACMG) guideline, the c.2802_2863-40del variant was classified as Likely Pathogenic (LP, PVS1 + PM2_supporting), while the c.2819 C > T (p.Ala940Val) variant was classified as the Uncertain Significance (VUS, PM2_supporting + PM3 + PP2 + PP3) [9]. The c.2819 C > T (p.Ala940Val) variant was confirmed in the mother using mass spectrometry (Fig. 2B). The c.2802_2863-40del variant was validated by Sanger sequencing in the family (Fig. 2C). Bioinformatics analyses predicted the c.2819 C > T (p.Ala940Val) variant to be disease-causing, and the c.2802_2863-40del variant was indicated to disrupt an important splicing site in the wild-type gene (Tables 1 and 2).

Fig. 2

Genetic analysis of the PI4KA variant in a family pedigree. (A) Family pedigree showing the inheritance pattern of the PI4KA variant. (B) Confirmation of the variant c.2819 C > T (p.Ala940Val) in the mother by mass spectrometry. (C) Validation of the variant c.2802_2863-40del by Sanger sequencing in the family

Table 1 Conservation prediction of the two variants by bioinformational computer softwares

Table 2 Functional prediction of the variant by SpliceAI

Minigene assay confirmed that the PI4KA variant c.2802_2863-40del (NM_058004.3) affected the mRNA splicing

To investigate the effect of the PI4KA c.2802_2863-40del variant on splicing, we constructed a genomic DNA fragment including Exon 23, Intron 23, Exon 24, Intron 24, Exon 25, Intron 25 and Exon 26 into the pMini-CopGFP (Hitrobio.tech, China). This procedure was carried out for both the wild-type and the mutant sequences (Fig. 3A). RT-PCR followed by agarose gel electrophoresis revealed a single band for the wild type construct, corresponding to the expected 367 bp size, whereas the mutant construct displayed two distinct bands at the anticipated sizes of 345 bp and 296 bp (Fig. 3B). Sanger sequencing of these products confirmed normal splicing in the wild-type construct and revealed two aberrant splicing patterns in the mutant: the exclusion of exon 24 and the retention of intron 24 (Fig. 3C and E). The splicing schematic diagram was shown in Fig. 3F. The sequencing data were consistent with the gel electrophoresis results, with the two bands corresponding to the expected sizes of 345 bp and 296 bp.

Fig. 3

Analysis of the PI4KA variant c.2802_2863-40del in the pMini-CopGFP Vector. (A) Schematic representation of the genomic DNA fragment cloned into the pMini-CopGFP Vector, including Exon 23, Intron 23, Exon 24, Intron 24, Exon 25, Intron 25, and Exon 26 for both the wild type (WT) and the mutant (Mut) PI4KA variant. (B) Agarose gel electrophoresis of RT-PCR products. Lane 1: Wild type, showing a single band at 367 bp. Lane 2: Mutant type, showing two bands at 345 bp and 296 bp, indicating alternative splicing events. (C-E) Sanger sequencing of the WT and mutant PI4KA variants. Normal splicing in the WT type. (D) Deletion of Exon 24 in the mutant type. (E) Insertion of Intron 24 in the mutant type. (F) Splicing schematic diagram illustrating the normal and abnormal splicing events in the WT and mutant PI4KA variants. The expected sizes of the splicing products are indicated

Functional analysis of PI4KAvariant kinase activity

A comparison of the amino acid sequence homology at position A940 of PI4KA protein was depicted in Fig. 4A. The three-dimensional structures of both the wild-type and the mutated PI4KA (c.2819 C > T, p.Ala940Val) were predicted using the Swiss-model website (Fig. 4B). To assess the enzymatic activity of wild-type and mutant PI4KA protein fragments, we purified both the wild type and p.Ala940Val mutant form of PI4KA enzyme, as shown in Fig. 4C, and conducted enzyme activity assays with the ptt5 plasmid serving as the negative control. As demonstrated in Fig. 4D, the mutant enzyme (p.Ala940Val) exhibited a marked reduced in catalytic activity compared to wild-type enzyme.

Fig. 4

Analysis of the PI4KA Protein Homology and Enzyme Activity. (A) Comparison of PI4KA protein homology at the position of amino acid A940. The alignment depicts the conservation of amino acid A940 across various species. (B) Predicted 3D structure of the wild type (WT) and mutant (c.2819 C > T, p.Ala940Val) PI4KA proteins. The structures, generated using the Swiss-Model website, illustrate the potential conformational changes due to the p.Ala940Val mutation. (C) Purification of the wild type and p.Ala940Val mutant form of the PI4KA enzyme. (D) Enzyme activity assay for the wild type and p.Ala940Val mutant PI4KA enzymes. The plot compares the catalytic activities of the WT and mutant enzymes, with the ptt5 plasmid used as a negative control. The results indicate a marked decrease in the catalytic activity of the mutant enzyme (p.Ala940Val) relative to the WT enzyme. The experiments were performed in triplicate

Discussion

The clinical phenotypic diversity of PI4KA gene mutations highlights the complex relationship between genes and diseases. Despite the fact that PI4KA mutations are typically inherited in an autosomal recessive manner, the spectrum of mutations can give rise to differences in clinical outcomes. Certain mutations may cause neurodevelopmental abnormalities, including spastic quadriplegia and cerebellar hypoplasia [10]. Conditions such as perisylvian polymicrogyria, which are linked to PI4KA mutations, are often characterized by severe movement disorders and other neurological dysfunctions. Moreover, PI4KA mutations may contribute to pathologies affecting the gastrointestinal and immune systems involving multiple systems [1, 11].

Prenatal studies investigating PI4KA gene variants are limited, yet the existing literature shows the gene’s critical role in nervous system development [12]. For example, point mutation, like c.2386 C > T, typically occurring in the gene’s exons and potentially leading to amino acid substitutions that may impair enzyme functionality [10]. The three fetuses in the family at 16, 28, and 24 gestational weeks all carried compound heterozygous mutations in the PI4KA gene (paternally transmitted c.2386 C > T; p.R796X nonsense mutation and maternally transmitted c.5560G > A; p.D1854N missense mutation), presenting with perisylvian polymicrogyria, cerebellar hypoplasia, and arthrogryposis [10]. The PI4KA gene biallelic mutations p.(Tyr1623Asp) and p.(Asp1854Asn) led to a spectrum of conditions affecting the nervous, intestinal, and immune systems, including hypomyelinating leukodystrophy, intestinal atresia, and immunodeficiency [11]. A study in 2021 identified 10 patients with biallelic PI4KA variants, presenting with a wide range of symptoms including hypomyelinating leukodystrophy, developmental delay, spastic paraparesis, epilepsy, immunodeficiency, gastrointestinal issues, and genitourinary abnormalities, highlighting the diverse and severe nature of PI4KA-related disorders [13]. Another study in 2023 reported on a patient (MD-610) with acute gait instability at 20 months old, suspected to have a post-infectious cerebellar syndrome. Brain MRI revealed hypomyelination and mild cerebellar atrophy. The patient was later diagnosed with compound heterozygosity for two novel PI4KA mutations (c.3845 C > T and c.2750T > C) and developed progressive spasticity in lower limbs between 2 and 3 years of age, with preserved cognitive and language abilities [14]. A newborn with compound heterozygous PI4KA mutations (c.5846T > C, p.Leu1949Pro; c.3453 C > T, p.Gly1151=) presented with neonatal sepsis, severe diarrhea, and immunodeficiency, diagnosed as gastrointestinal and immunodeficiency syndrome 2 (GIDID2) [1]. Two novel compound heterozygous variants in the phosphatidylinositol 4-kinase alpha gene (PI4KA), NM_058004.4: c.3883 C > A; c.5785 A > C; p. His1295Asn; p.Thr1929Pro, were revealed in two sisters presenting with progressive pure hereditary spastic paraparesis [15].

However, in the current study, the fetus carrying PI4KA gene mutations (c.2802_2863-40del; c.2819 C > T, p.Ala940Val) showed no abnormalities on brain MRI. The cerebellar hemispheres, vermis, brain, brainstem, corpus callosum, brain sulci, and gyri appeared normal, with no obvious dilation of the lateral ventricles and the fourth ventricle was of normal size. The fetal presentation was characterized by ileal obstruction with dilated jejunum and ileum, a small colon, and an increased volume of amniotic fluid. This observation suggested that PI4KA gene mutations may trigger different pathophysiological processes in different individuals, leading to a diverse array of clinical manifestations. Our experimental findings confirmed that one of these two PI4KA gene variants, located at a splice site, results in the production of alternative transcripts, while the other missense mutation leads to a decrease in enzyme activity. Notably, these variants differ from previously reported PI4KA mutations in that they do not elicit neurological changes in the fetus. This discovery offers valuable perspectives for prenatal diagnostic counseling.

The PI4KA gene’s multifaceted role within the cell underlies the broad spectrum of diseases arising from its mutations. PI4KA is a pivotal regulator of phosphatidylinositol 4-phosphate (PI4P) generation and function, which is critical for the metabolism of key phospholipids including phosphatidylserine (PS), phosphatidylethanolamine (PE), and sphingomyelin (SM). Deficiencies in PI4KA are linked to aberrant phospholipid metabolism and actin cytoskeleton disruptions, which are primary factors in myelination defects [4]. Mutations in the PI4KA gene lead to a range of phenotypes, stemming from disturbances in the intricate PI4KIIIα-TTC7-FAM126 complex’s catalytic and interactive functions [11]. Recent research has illuminated the importance of the PI4KA-TTC7B-FAM126A complex in PI4KA’s functionality, facilitating its assembly, membrane recruitment, and PI4P generation-processes that are essential for cell signaling and structure [16]. Furthermore, the novel calcineurin isoform CNAβ1, anchored to the plasma membrane and Golgi via palmitoylation, interacts with the PI4KA complex, and modulates PI4P production [17]. Calcineurin also directly binds to and influences PI4KA activity through proximity to phosphorylation site [18]. These discoveries uncover previously unknown regulatory pathways of PI4KA, enhancing our understanding of its significance in cellular signaling pathways. As a key enzyme in phosphatidylinositol synthesis, PI4KA is integral to both signaling and membrane lipid metabolism. Consequently, disruptions caused by gene mutations can result in widespread systemic involvement, complicating the diagnostic and prognostic challenges faced in clinical settings.

These findings guide future research directions. Firstly, the screening for PI4KA gene mutations should be broadened to identify more mutation types and their corresponding clinical phenotypes. Secondly, studies in cell and animal models can provide a deeper understanding of how PI4KA gene mutations affect embryonic development and cell function. Additionally, investigating the mechanisms by which PI4KA gene mutations contribute to disease occurrence will provide a theoretical basis for the development of new treatments.

Due to the high molecular weight of the full-length human PI4KA protein, direct functional analysis presents significant technical challenges. To overcome these, we adopted a domain-focused approach, studying specific protein regions predicted to be critical for function. Additionally, cell-based assays were employed to assess the activity of PI4KA in a cellular context. Although these methods do not provide a complete picture of the full-length protein’s function, they offer valuable insights into the protein’s activity and its role in cellular pathways. This study underscores the importance of in-depth exploration of PI4KA gene mutations in clinical practice. The normal development of the fetal nervous system in this case challenges our traditional understanding of the relationship between mutations and disease phenotypes. The neurodevelopmental disorders associated with PI4KA exhibit heterogeneity, with different patients manifesting a variety of symptoms and severity. In this case, the fetus may belong to a normal phenotype, or the symptoms may not have yet progressed to a detectable stage.

In summary, through the discovery of novel mutations in the PI4KA gene, not only expands our understanding of the mutation spectrum of this gene but also explores the correlation between genotypes and clinical phenotypes, which is of great significance for promoting early diagnosis, guiding clinical management. The relationship between PI4KA gene mutations and clinical phenotypes reveals the complexity of gene function and the significance of individual differences. In the future work, we will continue to investigate the functions and mechanisms of the PI4KA gene, aiming to provide new insights into the understanding of related diseases.